rs35518112 chr10:86960623 T>G
- Sequence
ctagtggtaagaaagcagtgctgc[T/G]tctgaccctaccctctgcagctgc
- ASB in cell types
- SK-N-SH (neuroblastoma) foreskin keratinocyte epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -0.46 | 1.09 | 1.33 | |||
| foreskin keratinocyte | 0.23 | n/a | 2.33 | |||
| epidermal keratinocytes | 1.94 | -2.61 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Muscle_Skeletal, Nerve_Tibial, Thyroid