rs355417 chr5:77972809 C>T
- Sequence
tcctccaggactacccgcacccca[C/T]agtcgcgtcaaaagcgccccatcc
- ASB in cell types
- RWPE2 GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | 2.10 | -1.93 | 2.00 | |||
| GM12878 (female B-cells) | 0.55 | 0.16 | 1.29 |
Items per page:
1 – 2 of 2