rs35586421 chr3:183826819 G>A
- Sequence
ctgggttagccagcctggcagatg[G/A]cgcttgggactaaaattctccatc
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.38 | 1.35 | 2.02 | n/a | No Hit | |||
| FOXA1_HUMAN | -0.62 | 1.62 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis