rs35656218 chr10:1056856 C>G
- Sequence
tgtggggtcgcgtcagtgcggaga[C/G]agcggtgtcctgcgcgtcttcggg
- ASB in cell types
- keratinocytes spleen CD14+ monocytes
- ASB for transcription factors
- SNAI2_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.44 | 1.50 | n/a | No Hit | |||
| STAT1_HUMAN | -3.00 | 1.96 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis