rs357117 chr3:13277961 G>A
- Sequence
gctcccggcaggaccctcctgagg[G/A]tggcttcctcctgcccattaggac
- ASB in cell types
- breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | 1.79 | -1.38 | 1.50 |
Items per page:
1 – 1 of 1