rs35714 chr12:100576884 G>A
- Sequence
ctttgcctctgtaagcatcctaga[G/A]tttatagtattatgaccatcagtc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.07 | n/a | 2.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, parkinsons disease, response to lithium treatment for bipolar disorder, salmonella-induced pyroptosis
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Nerve_Tibial, Pancreas, Testis, Thyroid