rs35739 chr12:100554737 C>T
- Sequence
aaatcaggtaattggtcattcaag[C/T]gaaaatgaagcaaattttaagcaa
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) epidermal keratinocytes CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- TRI22_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TRI22_HUMAN | -0.80 | 1.44 | 1.28 | n/a | n/a |
Items per page:
1 – 1 of 1