rs357522 chr9:95427176 G>A
- Sequence
gtgcaaatcaaggttgtttttgac[G/A]gactaacttaaaaatactgataca
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma) HEK293T (embryonic kidney)
- ASB for transcription factors
- NRF1_HUMAN IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.50 | -0.15 | 1.42 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.16 | 1.61 | 1.33 | n/a | No Hit | |||
| IKZF2_HUMAN | -1.09 | 1.35 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, height, premature ovarian failure, resistance to kuru in aged women despite likely exposure, schizophrenia