rs35816837 chr19:45645645 C>A
- Sequence
ccggagtatagtctctctagaccc[C/A]cctcctcgcccgttcagaaccaat
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) hMADS-3 (adipose-derived stem cells)
- ASB for transcription factors
- ASH1L_HUMAN KLF11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ASH1L_HUMAN | n/a | 2.74 | 2.00 | n/a | n/a | |||
| KLF11_HUMAN | -1.18 | 1.83 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood