rs35867984 chr8:29719478 G>A
- Sequence
tgccttagtctcaatgcagcctgt[G/A]gggtgaggaggtgactcttgccct
- ASB in cell types
- breast tumor tissue ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 1.91 | -0.16 | 2.00 | |||
| ZR-75-1 (invasive ductal carcinoma) | -1.25 | 1.66 | 2.00 |
Items per page:
1 – 2 of 2