rs359288 chr10:17288181 C>T
- Sequence
ttagcatcttttgaatacaacagt[C/T]tcctatcctgacagccttctcttg
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.46 | 1.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, spine bone mineral density (bmd), total cholesterol, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Prostate, Spleen, Testis, Thyroid