rs35941 chr5:54310465 T>C
- Sequence
catgtacagaaacgcctcagttat[T/C]cggagatcagacatccggcagcct
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts GM12878 (female B-cells)
- ASB for transcription factors
- ETV1_HUMAN GATA1_HUMAN FOXK2_HUMAN ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETV1_HUMAN | -2.63 | 2.41 | 1.50 | n/a | No Hit | |||
| GATA1_HUMAN | -0.44 | 1.77 | 1.78 | n/a | No Hit | |||
| FOXK2_HUMAN | -0.96 | 1.43 | 1.78 | n/a | n/a | |||
| ATF7_HUMAN | -0.13 | 2.02 | 1.67 | n/a | n/a | |||
| ZN316_HUMAN | -2.40 | 1.76 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, irritible bowel syndrome, ldl cholesterol, maternal transmission distortion, prop taste detection threshold, salmonella-induced pyroptosis, serum creatinine, systolic blood pressure (sbp), total cholesterol, transmission distortion