rs359648 chr7:128362379 A>G
- Sequence
atctctcaaaaatactgtttcaga[A/G]atgtctgccagaaagaatggtgag
- ASB in cell types
- HEK293 (embryonic kidney) GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.21 | 0.74 | 1.94 | |||
| GM23248 | -0.31 | 1.52 | 1.42 |
Items per page:
1 – 2 of 2