rs35979939 chr9:17116413 C>T
- Sequence
cacccaacatgataaaagtttatt[C/T]agctgaaattaaataaggatgctg
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.27 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Pancreas, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid