rs36012661 chr12:56653933 A>G
- Sequence
ccctgagaaagagaatgcattccc[A/G]gggggaggtctctaaaatggccgc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.21 | 0.65 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.66 | -0.09 | 2.00 | |||
| GM12878 (female B-cells) | 0.45 | -0.01 | 1.17 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Testis