rs360230 chr13:19239438 A>T
- Sequence
tcttaacttctattcctgagggag[A/T]agccaagagttgaacatgttctcc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -1.50 | 1.44 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis