rs36068360 chr1:203488238 G>C
- Sequence
gaggtggataagatgctcccggcc[G/C]ggcgcggtggctcacgcctgtaat
- ASB in cell types
- upper lobe of left lung 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 1.69 | -1.47 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 0.19 | 2.20 | 2.00 |
Items per page:
1 – 2 of 2