rs360745 chr3:12984399 G>A
- Sequence
tggatacagccccacaggcccagg[G/A]ctgagctaacaagaatgccattag
- ASB in cell types
- A549 (lung carcinoma) T47D (invasive ductal carcinoma) epidermal keratinocytes CD34+ hematopoietic stem cells
- ASB for transcription factors
- RAD21_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.99 | 0.39 | 1.75 | n/a | n/a | |||
| SMC3_HUMAN | 0.73 | -0.12 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2