rs360804 chr2:62712262 G>A
- Sequence
catgggtagagaagcagataggtt[G/A]gtagatttggttgggaaggatgtg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.13 | 0.62 | 1.98 | |||
| K562 (myelogenous leukemia) | -0.36 | 0.47 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI ldl cholesterol levels, ldl cholesterol levels in current drinkers, ldl cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df), ldl cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)
GRASP body mass index (bmi), hdl cholesterol, ldl cholesterol, paternal transmission distortion, total cholesterol, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Whole_Blood