rs36231 chr16:2148167 G>C
- Sequence
ggtgtgtttgccaagccagggctg[G/C]agcttcctggacccgcctaccctg
- ASB in cell types
- breast tumor tissue MDA-MB-453 (breast adenocarcinoma) K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.06 | 1.82 | 2.10 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid