rs363598 chr21:29640839 T>C
- Sequence
atgatcactgcagggaaaaggagg[T/C]ggtgtgatgtttttctattaggca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 0.56 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined)
GRASP autism spectrum disorder, attention deficit-hyperactivity disorder (adhd), bipolar disorder, major depressive disorder, and schizophrenia, coronary artery disease (cad), prop taste detection threshold, sporadic creutzfeldt-jakob disease