rs3650 chr17:77419753 T>C
- Sequence
ggaagcagcaagtcccggtcactg[T/C]gggctcgggttacagatggttgag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | 1.62 | -1.93 | 1.50 | 1.26 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
