rs365943 chr11:5476569 G>A
- Sequence
tctcttaggtctccagcctaaact[G/A]agaccatcagtatttcatgtattt
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.18 | 0.85 | 2.02 | |||
| A549 (lung carcinoma) | -0.24 | 0.39 | 2.02 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, fasting blood glucose, hdl cholesterol, homa-ir, hypertension (early onset hypertension), ldl cholesterol, total cholesterol