rs366565 chr9:17063705 T>C
- Sequence
cagtagaacctcaggtggaaccaa[T/C]agcactgagacccacctagtcatg
- ASB in cell types
- HepG2 (hepatoblastoma) HCT-116 (colon carcinoma) CD34+ hematopoietic stem cells HCT-116-RAD21-mAC
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.32 | 0.16 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1