rs367342 chr20:43657308 G>T
- Sequence
ggtccagagcctctgacccacact[G/T]ggaagtcatggaccgttcaggggt
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.28 | 0.91 | 2.05 | |||
| GM12878 (female B-cells) | 0.61 | 0.57 | 1.38 | |||
| HEK293T (embryonic kidney) | 1.10 | -0.35 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Spleen, Testis, Whole_Blood