rs367389 chr19:3305054 T>C
- Sequence
tgcactccagcttgggcgacagaa[T/C]gagacttttttttaaaattacttt
- ASB in cell types
- erythroid cells foreskin keratinocyte neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.16 | -2.46 | 1.50 | |||
| foreskin keratinocyte | 0.62 | n/a | 2.67 | |||
| neutrophils | 1.14 | -0.13 | 1.50 |
Items per page:
1 – 3 of 3