rs367597 chr5:671893 C>G
- Sequence
ggggagtgcagcccacccttcccc[C/G]gggctgggtaccacgggggagggg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) upper lobe of left lung PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.12 | 0.81 | 2.06 | |||
| upper lobe of left lung | 1.06 | -1.06 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 2.63 | n/a | 4.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid