rs36929 chr7:123865690 C>T
- Sequence
cagtgtccaaggcctgagaaatac[C/T]atgaggtttggctggtgacacctg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.10 | 0.71 | 1.50 | |||
| foreskin keratinocyte | n/a | 0.52 | 2.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.04 | 0.88 | 2.13 | |||
| HEK293 (embryonic kidney) | -0.30 | 0.63 | 1.96 | |||
| prostate gland | 0.87 | -0.87 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, irritible bowel syndrome, ldl cholesterol change with statins, microalbuminuria, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio