rs369421 chr10:8057214 C>T
- Sequence
ctccactcccctccccttcctctc[C/T]cttaagattttagtttcagtattg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.21 | 0.83 | 1.62 | |||
| GM12878 (female B-cells) | 0.20 | 0.50 | 1.32 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, classical hodgkins lymphoma, hdl cholesterol, rheumatoid arthritis, total cholesterol