rs372225 chr9:125261770 A>G
- Sequence
cccgggcggaactacagctcccag[A/G]ggcccccgcggcgctgcgcacgcg
- ASB in cell types
- fetal bone marrow-derived mononuclear cells GM12878 (female B-cells) HepG2 (hepatoblastoma) VCaP (prostate carcinoma)
- ASB for transcription factors
- KMT2A_HUMAN FOXK2_HUMAN ZN143_HUMAN CTCFL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 0.08 | 2.73 | 1.42 | n/a | n/a | |||
| FOXK2_HUMAN | 2.17 | -2.21 | 1.33 | n/a | n/a | |||
| ZN143_HUMAN | 0.59 | -1.74 | 1.50 | -1.56 | Weak Concordant | |||
| CTCFL_HUMAN | -1.25 | 1.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood