rs37238 chr5:90529159 C>T
- Sequence
gaatatttcacgccaacataaagt[C/T]gtgggagaaatgctgtgtttgggt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293T (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.01 | -0.15 | 1.99 | |||
| HEK293T (embryonic kidney) | -0.14 | 0.81 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.19 | 0.94 | 2.59 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, neuroblastoma (brain cancer), paternal transmission distortion, serum creatinine, transmission distortion, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood