rs3731586 chr2:31523958 T>C
- Sequence
ctaccctatattcagattaagaag[T/C]tccacgatcatgctaacttgaaag
- ASB in cell types
- K562 (myelogenous leukemia) LNCaP (prostate carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.31 | 0.58 | 2.00 | |||
| LNCaP (prostate carcinoma) | -2.43 | 1.94 | 2.00 | |||
| GM12878 (female B-cells) | 1.49 | n/a | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, hdl cholesterol, homa-b, homa-ir, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid