rs3732508 chr3:56801733 G>A
- Sequence
gtccttggccggaccgctggccgg[G/A]ggtagctccaggctgcagttcgct
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.48 | 0.52 | 1.50 | |||
| GM12878 (female B-cells) | 0.60 | 0.61 | 1.27 | |||
| HEK293T (embryonic kidney) | 1.08 | -0.34 | 2.67 |
Items per page:
1 – 3 of 3