rs3734760 chr6:107880503 G>A
- Sequence
acaacacaggctatcaaggagatc[G/A]aaagttgagcaggctgcaattaca
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | -0.01 | 1.17 | 1.47 | n/a | No Hit |
Items per page:
1 – 1 of 1