rs3736164 chr17:42387807 T>G
- Sequence
cctgcctccaaaagggcacagctg[T/G]ctcctgaaggagcgggaacagggc
- ASB in cell types
- periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.04 | 1.44 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg