rs3737502 chr8:108443634 C>T
- Sequence
gactgcgtctccccgccctctcac[C/T]ccgctgcctctaggttctgggaag
- ASB in cell types
- K562 (myelogenous leukemia) HCT-116 (colon carcinoma) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive) HAEC (human aortic endothelial cells)
- ASB for transcription factors
- USF1_HUMAN NR2C1_HUMAN CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF1_HUMAN | 0.60 | 1.96 | 1.62 | n/a | No Hit | |||
| NR2C1_HUMAN | 2.32 | -2.93 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.80 | 0.37 | 1.34 | n/a | No Hit | |||
| STAT1_HUMAN | 1.37 | -0.64 | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, infant head circumference, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen