rs3737577 chr1:101238976 G>T
- Sequence
accccggcttcctggggacacagg[G/T]ttggcaccatggggcccaccagcg
- ASB in cell types
- GM12878 (female B-cells) foreskin keratinocyte CD34+ hematopoietic stem cells GM12868 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.44 | 0.58 | 1.33 | |||
| foreskin keratinocyte | 0.76 | n/a | 2.67 | |||
| CD34+ hematopoietic stem cells | 2.46 | n/a | 2.00 | |||
| GM12868 (female B-cells) | 1.90 | n/a | 1.50 | |||
| D54 (glioblastoma) | -1.77 | 2.19 | 2.00 |
Items per page:
1 – 5 of 5