rs3738890 chr2:46699580 G>C
- Sequence
gcccccggctgtcgcccccgcacc[G/C]cggcggaggcagcgccggcctctg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293T (embryonic kidney) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | -0.12 | 1.97 | |||
| HEK293T (embryonic kidney) | -0.22 | 1.21 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.22 | 0.81 | 1.28 | |||
| HepG2 (hepatoblastoma) | 0.72 | -0.34 | 1.98 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Thyroid