rs3738961 chr2:223837588 G>C
- Sequence
catggctgcttcccacaatgccct[G/C]gcactgaaagtgtgcagactcctc
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) A549 (lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | 1.44 | -1.17 | 2.00 | |||
| A549 (lung carcinoma) | 0.72 | -0.24 | 2.10 | |||
| foreskin keratinocyte | -2.32 | 1.45 | 2.50 |
Items per page:
1 – 3 of 3