rs3740799 chr11:35619764 G>A
- Sequence
cgagcggaccgcgcggcgcgtcct[G/A]gagctgcaccgcggacaggacgcc
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | n/a | 1.80 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic