rs3743337 chr15:36579756 C>T
- Sequence
gggcaagccaagcaggcgaggacc[C/T]gggcctgtgccgctttgcctaccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -2.13 | 2.21 | 2.00 | 0.26 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
