rs374377 chr11:61609612 G>A
- Sequence
agggctcccggggggtggggtccc[G/A]tgtgtgtgtgtgtgtgtgcgtgtg
- ASB in cell types
- HepG2 (hepatoblastoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.34 | 0.57 | 1.30 | |||
| VCaP (prostate carcinoma) | -0.31 | 0.84 | 2.12 |
Items per page:
1 – 2 of 2