rs374678 chr15:90813655 T>C
- Sequence
tacccaccttggctcccaaagtgc[T/C]gggatgacaggcgtgagccactgt
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.20 | 0.65 | 1.34 | |||
| HEK293 (embryonic kidney) | 0.51 | -0.12 | 1.79 |
Items per page:
1 – 2 of 2