rs3752576 chr6:122471928 C>A
- Sequence
cgcgcagcgctgagactgcgcatg[C/A]gcgtcactagacgacacggctgtc
- ASB in cell types
- periferal blood macrophages CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.48 | -0.16 | 2.04 | n/a | No Hit | |||
| STAT1_HUMAN | 1.55 | -0.15 | 1.92 | n/a | No Hit | |||
| GABPA_HUMAN | -0.12 | 1.02 | 1.37 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood