rs3753535 chr1:178867836 T>C
- Sequence
gacccctcccgaaaacaaaggtca[T/C]gtcaatgaaatataactcttatgc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.60 | 0.80 | 2.81 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, hip bone mineral density (bmd), irritible bowel syndrome, primary rhegmatogenous retinal detachment, rheumatoid arthritis, schizophrenia, tetrology of fallot
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Small_Intestine_Terminal_Ileum, Testis, Thyroid