rs3757594 chr7:76049326 G>A
- Sequence
gaatgtaccaaatgcttttgcgct[G/A]cggtgaagtgggggcccagctgta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG8R_HUMAN NCOR1_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG8R_HUMAN | 2.05 | -2.67 | 1.50 | n/a | n/a | |||
| NCOR1_HUMAN | 1.36 | -0.69 | 1.44 | n/a | n/a | |||
| HTF4_HUMAN | 1.64 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood