rs3759345 chr12:6753512 G>T
- Sequence
gatgccccttggggagaggcgggc[G/T]ctctgtgggcgacgaggcggggcg
- ASB in cell types
- neural cell foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.24 | 0.90 | 1.00 | |||
| foreskin keratinocyte | 1.53 | -1.47 | 2.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Spleen, Thyroid, Whole_Blood