rs37595 chr16:75463065 G>C
- Sequence
tatatatatagagagagagaaaga[G/C]agcagagagagagaaagagaaaca
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -0.03 | 0.86 | 1.31 |
Items per page:
1 – 1 of 1