rs3760659 chr19:41263199 A>C
- Sequence
acgtgtggctcaggaggcagtggg[A/C]gtctgcatcatgtatcccgattgc
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- HTF4_HUMAN MTA2_HUMAN BHE40_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | -0.64 | 1.59 | 1.61 | n/a | No Hit | |||
| MTA2_HUMAN | -1.67 | 1.46 | 1.33 | n/a | n/a | |||
| BHE40_HUMAN | -1.71 | 1.49 | 1.33 | n/a | No Hit | |||
| GATA1_HUMAN | 1.81 | -1.15 | 1.75 | n/a | No Hit | |||
| EP300_HUMAN | -0.09 | 1.43 | 1.48 | n/a | n/a |
Items per page:
1 – 5 of 11
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Spleen, Thyroid, Whole_Blood