rs376208 chr9:4657864 A>T
- Sequence
ttggtggcatctgtttggtaaatg[A/T]ctctagttttactgtttacattgg
- ASB in cell types
- HepG2 (hepatoblastoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.64 | 0.23 | 1.28 | |||
| ZR-75-1 (invasive ductal carcinoma) | 2.31 | -3.46 | 2.00 |
Items per page:
1 – 2 of 2